View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_292 (Length: 227)
Name: NF6863A_low_292
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_292 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 29280301 - 29280091
Alignment:
| Q |
1 |
actaatggccattttacaactgtcgtcaaagaattttgaaccattgtttaaattgttagcaatcgcaattgcagtcgcaatataaaaagttttgaggtct |
100 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||| |
|
|
| T |
29280301 |
actaatgaccattttacaactgtcgttaaagaattttgaaccattgtttaaattgttggcaatcgcaat------------ataaaaggttttgaggtct |
29280214 |
T |
|
| Q |
101 |
--gcaacggtatcacaaccattagaccacatcagctgccttttttatggtacaaaggtttgcagcgtaaccacaatttaaaatcatgatttaaactgtgt |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
29280213 |
ctgcaatggtatcacaaccattagaccacatcagctgc-ttttttatggtacaaaggtttgcagcctaaccacaatttaaaatcatgatttaaactttgt |
29280115 |
T |
|
| Q |
199 |
tccaaataattatatgattaaaat |
222 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
29280114 |
tccaaataattataagattaaaat |
29280091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 183
Target Start/End: Complemental strand, 42945084 - 42945056
Alignment:
| Q |
155 |
gtttgcagcgtaaccacaatttaaaatca |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42945084 |
gtttgcagcgtaaccacaatttaaaatca |
42945056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University