View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_301 (Length: 224)
Name: NF6863A_low_301
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_301 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 224
Target Start/End: Original strand, 52373397 - 52373610
Alignment:
| Q |
11 |
atggacatcatggttgttaatgaagaaacacttgaagctgttgaagatggtgttgaaggagaaatttgggtttcatctccaagtaatgcctctggttacc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373397 |
atggacatcatggttgttaatgaagaaacacttgaagctgttgaagatggtgttgaaggagaaatttgggtttcatctccaagtaatgcctctggttacc |
52373496 |
T |
|
| Q |
111 |
ttggtcacccttctttaacaagagaagtttttcatgcaagaatcagaaacacagttcgtaagtgttttcttcgaacgggtgacaaaggaatcgtaaaagg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373497 |
ttggtcacccttctttaacaagagaagtttttcatgcaagaatcagaaacacagttcgtaagtgttttcttcgaacgggtgacaaaggaatcgtaaaagg |
52373596 |
T |
|
| Q |
211 |
agaaaacaggtatc |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52373597 |
agaaaacaggtatc |
52373610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University