View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_303 (Length: 223)
Name: NF6863A_low_303
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_303 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 6 - 216
Target Start/End: Original strand, 37507756 - 37507967
Alignment:
| Q |
6 |
aagtaagtcaactatgtgttcataaatcattatgtgagtcccgcaaaaattttagagcacacaagttttttagagtgcattgtttgtatttttcttaaaa |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37507756 |
aagtaagtcaactatgtgttgataaatcattatgtgagtcccacaaaaattttagagcgcacaagttttttagagtgcattgtttgtatttttcttaaaa |
37507855 |
T |
|
| Q |
106 |
gtgtttcatccaaacatgccacagattagttggtctattgcactcttgttactcactaaataaaatttaaacatccacaataaaaaagagacaaagt-aa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37507856 |
gtgtttcatccaaacatgccacagattagttggtctattgcactcttgttactcactaaataaaatttaaacatccacaataaaaaagagacaaagtaaa |
37507955 |
T |
|
| Q |
205 |
atattattttat |
216 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37507956 |
atattattttat |
37507967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 110 - 217
Target Start/End: Complemental strand, 37848377 - 37848268
Alignment:
| Q |
110 |
ttcatccaaacatgccacagattagttggtctattgcactcttgttactcactaaataaaatttaaacatccacaat-aaaaaagagacaaagt-aaata |
207 |
Q |
| |
|
||||||||| || ||||| ||||||||| || | ||| |||||||| |||||| ||||||||||| | ||| || | |||||||||||||||| ||||| |
|
|
| T |
37848377 |
ttcatccaattataccacaaattagttggcctttggcattcttgttattcactacataaaatttaaccttccccagtaaaaaaagagacaaagtaaaata |
37848278 |
T |
|
| Q |
208 |
ttattttatc |
217 |
Q |
| |
|
|||||||||| |
|
|
| T |
37848277 |
ttattttatc |
37848268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University