View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_317 (Length: 215)
Name: NF6863A_low_317
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_317 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 198
Target Start/End: Original strand, 40288843 - 40289020
Alignment:
| Q |
21 |
aatgcagtcaagtacaaaactttcatatatctagctggttctgcttcagcagaagttattgctgatcgtgcactttgtcctatggaggcagtcaaagttc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
40288843 |
aatgcagtcaagtacaaaactttcatatatctagctggttctgcttcagcagaagttattgctgattgtgcactttgtcctatggaggctgtcaaagttc |
40288942 |
T |
 |
| Q |
121 |
gtgtacaaactcagcctggctttgctcgtggtttgtctgatgggttacccaagtttgtcaaggctgatggtgtttctg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40288943 |
gtgtacaaactcagcctggctttgctcgtggtttgtctgatgggttacccaagtttgtcaaggctgatggtgtttctg |
40289020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University