View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_319 (Length: 215)
Name: NF6863A_low_319
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_319 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 54891867 - 54892046
Alignment:
| Q |
17 |
atcatagaacaatggaatatcaacaacaatatggtaggagtttattccttaaaaaacaatatgcatgtttatgtttatgtttcctcagattatgtgtaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54891867 |
atcatagaacaatggaatatcaacaacaatatggtaggagtttattccttaaaaaaaaatatgcatgtttatgtttatgtttcctcagattatgtgtaca |
54891966 |
T |
|
| Q |
117 |
actgtacattgatgctttgagcttgcatttgagtggtgcannnnnnnctttctgtttgggtagaattgatggataattgt |
196 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54891967 |
actgtacattgatgctttgagtttgcatttgagtggtgcatttttttctttctgtttgggtagaattgatggataattgt |
54892046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 88 - 141
Target Start/End: Original strand, 54879249 - 54879303
Alignment:
| Q |
88 |
tgtttatgtttcctcagattatgtgtacaactgtaca-ttgatgctttgagcttg |
141 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
54879249 |
tgtttatgttccttcagattatgtgtacaactgtgcatttgatgctttgagcttg |
54879303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 84 - 117
Target Start/End: Original strand, 54879064 - 54879097
Alignment:
| Q |
84 |
tttatgtttatgtttcctcagattatgtgtacaa |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
54879064 |
tttatgtttatgttccctcagattatgtgtacaa |
54879097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University