View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_329 (Length: 209)
Name: NF6863A_low_329
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_329 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 14 - 163
Target Start/End: Original strand, 13889200 - 13889349
Alignment:
| Q |
14 |
tgatatgaatgaaaaccgacattttataaatcaacttcaacaaataattgtcacaaatcatcaaccttatcacaaaaattattattattcattgacggta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13889200 |
tgatatgaatgaaaaccgacattttataaatcaacttcaacaaataattgtcacaaatcttcaaccttatcacaaaaattattattattcattgacggtg |
13889299 |
T |
|
| Q |
114 |
aataggtaattccacgaggtcacacaatccgaacactttaaagatgtccc |
163 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13889300 |
aataggtaactccacgagatcacacaatccgaacactttaaagatgtccc |
13889349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University