View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_33 (Length: 390)
Name: NF6863A_low_33
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 11 - 384
Target Start/End: Complemental strand, 10119909 - 10119532
Alignment:
| Q |
11 |
caaagagagaaggagtgttgcttttggtacaagcaaaaggaac-gcaaagcgccatatttctattaaaccgttatat----ctttaaagcaatgtaaaat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10119909 |
caaagagagaaggagtgttgcttttggtacaagcaaaaggaaccgcaaagcgccatatttctattaaaccgttatatatatctttaaagcaatgtaaaat |
10119810 |
T |
 |
| Q |
106 |
atcaaacactcaaccatgttataaccgtccctatattttcatttcatgattcattcattattttcagtgatgttatcttgttcagtgtttcaaaaaccca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119809 |
atcaaacactcaaccatgttataaccgtccctatattttcattgcatgattcattcattattttcagtgatgttatcttgttcagtgtttcaaaaaccca |
10119710 |
T |
 |
| Q |
206 |
acaggacggttcaatcggttgtaccttaaactgacggtttggttattttagcggttcaataccagtttcgttcgggttcaagcaatttaaggcagttgaa |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119709 |
acaggacggttcaatcggttgtaccttaaactgacggtttggtta-tttagcggttcaatcccagtttcgttcgggttcaagcaatttaaggcagttgaa |
10119611 |
T |
 |
| Q |
306 |
ccatgaaccatgaaccatgattcagaagttttgcttgtttgatgtcttatccgatttttaaaacattgatgtaattaat |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119610 |
ccatgaaccatgaaccatgattcagaagttttgcttgtttgatgtcttatccgatttttaaaacattgatgtaattaat |
10119532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University