View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_46 (Length: 375)
Name: NF6863A_low_46
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 2e-31; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 151 - 228
Target Start/End: Original strand, 7916150 - 7916227
Alignment:
| Q |
151 |
gatggaatgaaaccttgctaaaaccaacgttgttgttgttgctgttgatttttctgagtatgatgaaaatgttgaacg |
228 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7916150 |
gatggaatgaaaccttgataaaaccaacgttgtagttgttgctgttgatttttctgagtatgatgaaaatgttgaacg |
7916227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 292 - 360
Target Start/End: Original strand, 7916291 - 7916359
Alignment:
| Q |
292 |
gggtttgggctatagagagaaaattatatccgttgggtacgaacgagaaatgatgaaactgtaactgtt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7916291 |
gggtttgggctatagagagaaaattatatccgttgggtacgaacgagaaatgatgaaactgtaactgtt |
7916359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 7916033 - 7916091
Alignment:
| Q |
28 |
ttaatctcatatatagagaaaagggttgttctatattacagttattaacattttaatgt |
86 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7916033 |
ttaatctcatatattgagaaaagggttgttttatattacagttattaacattttaatgt |
7916091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University