View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_63 (Length: 350)
Name: NF6863A_low_63
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 330
Target Start/End: Complemental strand, 13879887 - 13879570
Alignment:
| Q |
8 |
ccaagaatatctcactctgtcaactgtcaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcatt |
107 |
Q |
| |
|
||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879887 |
ccaagaaaatctcact--gtcaactgttaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcatt |
13879790 |
T |
|
| Q |
108 |
cgccaccgccccttcgctactgccgccatgtctctggttgccatctcctacgctgctcctcgactcattcactatttcaacaccaatgagctgnnnnnnn |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
13879789 |
cgccaccgccccttcgctactgccgccatgtctctggttgccatctcctacgccactccacgactcattcgctatttcaacaccaatgagctgaacaaca |
13879690 |
T |
|
| Q |
208 |
nnnnnnnnnnnnnnnnngatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgt |
307 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879689 |
acaacaacaacgatgatgatgatgat---cttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgt |
13879593 |
T |
|
| Q |
308 |
gaggaaggaagagattgatgtct |
330 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13879592 |
gaggaaggaagagattgatgtct |
13879570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 34 - 197
Target Start/End: Complemental strand, 13875640 - 13875477
Alignment:
| Q |
34 |
tcaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcattcgccaccgccccttcgctactgccgc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||| ||| |||||| ||||||||||| || ||||||||| || |||| ||||||||||||| |
|
|
| T |
13875640 |
tcaacacaatggcattttcccgcctcctctcttcctgctaccgctcattcatggccgccgtgccttcactcattcgccgccaccccgtcgctactgccgc |
13875541 |
T |
|
| Q |
134 |
catgtctctggttgccatctcctacgctgctcctcgactcattcactatttcaacaccaatgag |
197 |
Q |
| |
|
|||||| || || |||||||||||| | || |||| |||||||| ||||||||||||||||||| |
|
|
| T |
13875540 |
catgtcactcgtagccatctcctacaccgcacctccactcattcgctatttcaacaccaatgag |
13875477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 235 - 330
Target Start/End: Complemental strand, 13875448 - 13875353
Alignment:
| Q |
235 |
atcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattgatgtct |
330 |
Q |
| |
|
||||||||||||| |||||| |||||| ||||||||| ||||||| |||| |||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13875448 |
atcttgttctctgtgattttgaggagaccgaggagtctttgatttttcggttgaatctggtcgccaacaacgtgaggaaggaagagattgatgtct |
13875353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 34 - 70
Target Start/End: Complemental strand, 13885756 - 13885720
Alignment:
| Q |
34 |
tcaacacaatggcattttcccgcctcctttcttcctc |
70 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
13885756 |
tcaacacaatggcattttcccgcttcctctcttcctc |
13885720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University