View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_high_13 (Length: 207)
Name: NF6864A_high_13
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_high_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 6 - 207
Target Start/End: Complemental strand, 44232090 - 44231889
Alignment:
| Q |
6 |
actaagttcattaataaatacaaccaacaaaactattgcaatactttcctggttttggccatacacaagagtcacatcacatgcacaagtccaaaattca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
44232090 |
actaagttcattaataaatacaaccaacaaaactattgccatactttcctggttttggccatacaaaagaggcacatcacatgcacaagtccaaaattca |
44231991 |
T |
 |
| Q |
106 |
catgcacaagtccaaaatatgcaatctttgataatgtacttacatcaattcacataaaaaagatagtgctaggatggaaacttttggcagtagtgaactt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44231990 |
catgcacaagtccaaaatatgcaatctttgataatgtacttacatcaattcacataaaaaagatagtgctaggatggaaacttttggcagtagtgaactt |
44231891 |
T |
 |
| Q |
206 |
ag |
207 |
Q |
| |
|
|| |
|
|
| T |
44231890 |
ag |
44231889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University