View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_high_5 (Length: 353)
Name: NF6864A_high_5
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 120 - 234
Target Start/End: Complemental strand, 41641954 - 41641841
Alignment:
| Q |
120 |
gtcatttatgtacaaataataatttactttctagaacattaacaatggaaaggggattaaaaagaacattaaacatagacatgtaactctaaacatgatc |
219 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41641954 |
gtcatttatgtacaaataataatttcctttctagaacattaacaatggaaaggg-attaaaaagaacattaaacatagacatgtaattctaaacatgatc |
41641856 |
T |
|
| Q |
220 |
atcatcattcatatc |
234 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
41641855 |
atcatcatccatatc |
41641841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University