View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_169 (Length: 292)
Name: NF6864A_low_169
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_169 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 35 - 292
Target Start/End: Complemental strand, 38417122 - 38416864
Alignment:
| Q |
35 |
atgagtgtaaggtgtttgtgaaaatgcttgcgagagaaatagaagaagaagaagttgaagagagggatttgtgtttgagttttggtttgggtttgtgttt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38417122 |
atgagtgtaaggtgtttgtgaaaatgcttgagagagaaatagaagaagaataagttgaagagagggatttgtgtttgagttttggtttggctttgtgttt |
38417023 |
T |
 |
| Q |
135 |
ggttactacatgtttcagtggtagcatgctgaactgaactgaaatcagagtgtttgtaaaattgtttttgttctatcacggtttcagt-aacatagtctt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
38417022 |
ggttactacatgtttcagtggtagcatgctgaactgaactgaaatcagagtgtttgtaaaattgtttttgttttgtcacggtttcagtaaacatagtctt |
38416923 |
T |
 |
| Q |
234 |
cttcaagtatgttttggtgcattgaccctatctgattcagaaaaagaacataggtacta |
292 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38416922 |
cttcgagtatgttttggtgcattgaccctatctgattcagaaaaagaacataggtacta |
38416864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University