View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_195 (Length: 278)
Name: NF6864A_low_195
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_195 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 7 - 274
Target Start/End: Original strand, 48684325 - 48684592
Alignment:
| Q |
7 |
aatttccagtctcctaatgtttttattctgtttatgaccttccacaaccaaggagttcttcacaaccatattgtgtcgtgatttcataaagatactctct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48684325 |
aatttccagtctcctaatgtttttattctgtttatgaccttccacaaccaaggagttcttcacaaccatattgtgtggtgatttcataaagatactctct |
48684424 |
T |
|
| Q |
107 |
tttagttccaaggtgttcagtggccttgacatcccatattggatgcacaacaaggacaaagaaagaaaaataaggaagaagtctaagtattggtgttttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48684425 |
tttagttccaaggtgttcagtggccttgacatcccatattggatgcacaacaaggacaaagaaagaaaaataaggaagaagttaaagtattggtgttttc |
48684524 |
T |
|
| Q |
207 |
caaccatgactattgtagtatttaggtttggagatatgtatgattttggttattgagaataatgtagc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48684525 |
caaccatgactattgtagtatttaggtttggagatatgtatgattttggttattgagaataatgtagc |
48684592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University