View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_223 (Length: 264)
Name: NF6864A_low_223
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_223 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 38322853 - 38322605
Alignment:
| Q |
1 |
actctttctatcacttcaatctctgaaggatggactttagattctgaaattgaggcatttatttgagcatcactttcgacaagtcgatatcctttgtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38322853 |
actctttctatcacttcaatctctgaaggatggactttagattctgaaattgaggcatttatttgagcattactttcgacaagtcgatatcctttgtttt |
38322754 |
T |
|
| Q |
101 |
ctttcagctgcacaaatacattcaacattatttgctactattaattaataagatcataagttcataaatatgattacattgaccatttagtatagaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38322753 |
ctttcagctgcacaaatacattcaacattatttgctactattaattaataagatcataagttcataaatatgattacattgaccatatagtatagaaaaa |
38322654 |
T |
|
| Q |
201 |
tgaacctgcactttttgccaatcagggttgtactttatggctaacacat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322653 |
tgaacctgcactttttgccaatcagggttgtactttatggctaacacat |
38322605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University