View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_251 (Length: 254)
Name: NF6864A_low_251
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_251 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 30103162 - 30103076
Alignment:
| Q |
20 |
cttggcatataccattaggtgaatttgagagggaaaacgatggttgaggagttgttcttctggaagggaagcaacaacccaaaccca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30103162 |
cttggcatataccattaggtgaatttgagagggaaaacgatggtggaggagttgttcttctggaagggaagcaacaacccaaaccca |
30103076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 181 - 247
Target Start/End: Complemental strand, 30102991 - 30102925
Alignment:
| Q |
181 |
atacaattttacttgtctgaatttttgttgttaaatcaatcttatgaataaatattgatattgttcg |
247 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30102991 |
atacaattttacttgtttgaatttttgttgttaaatcaatcttatgaataaatattgatattgttcg |
30102925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University