View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_262 (Length: 251)
Name: NF6864A_low_262
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_262 |
 | |
|
| [»] scaffold0099 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 148 - 240
Target Start/End: Complemental strand, 24922873 - 24922781
Alignment:
| Q |
148 |
tgggattgaagatagaagaagaggaaaatggtgacattattggtgagttttcgaggtcgtgttcgtttactacttcacaagaagatgattcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24922873 |
tgggattgaagatagaagaagaggaaaatggtgacattattggtgagttttcgaggccgtgttcgtttactacttcacaagaagatgattcat |
24922781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 148 - 240
Target Start/End: Complemental strand, 24998963 - 24998871
Alignment:
| Q |
148 |
tgggattgaagatagaagaagaggaaaatggtgacattattggtgagttttcgaggtcgtgttcgtttactacttcacaagaagatgattcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24998963 |
tgggattgaagatagaagaagaggaaaatggtgacattattggtgagttttcaaggtcgtgttcatttactacttcacaagaagatgattcat |
24998871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 24999110 - 24999047
Alignment:
| Q |
1 |
gggttctggtttctgttgtggatgacacgtgttcaacgtgggatactctgagggattttgctcc |
64 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24999110 |
gggttcgggtttctgttgtggatgacacgtgttcaacgtgggatattctgagggattttgctcc |
24999047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0099 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0099
Description:
Target: scaffold0099; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 148 - 240
Target Start/End: Complemental strand, 35946 - 35848
Alignment:
| Q |
148 |
tgggattgaagatagaagaa-gaggaaaa-tggtgacattattgg-tgagttttcgaggtcgt-gttcgtttact-acttcacaag-aagatgattcat |
240 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||| ||||||||||||| ||| ||||||||||| |||||||||| |||||||||||| |
|
|
| T |
35946 |
tgggattgaagatagaagaaagaggaaaaatggtgacattattggttgagttttcgaggccgtagttcgtttactaacttcacaagtaagatgattcat |
35848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University