View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_287 (Length: 249)
Name: NF6864A_low_287
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_287 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 45 - 249
Target Start/End: Complemental strand, 49825515 - 49825318
Alignment:
| Q |
45 |
agatttgattgaggcaaacagtcaggtaaattatgatcactttggttatatcnnnnnnnatattgtgatacgatcgtatttttatgcatgttggtaattt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
49825515 |
agatttgattgaggcaaacagtcaggtaaattatgatcactttggttatagcttttt---tattgtgatatgattgtatttttatgcatgttattaattt |
49825419 |
T |
 |
| Q |
145 |
ggagtgcgtttcatttgatcagggtaaaccctcaagcgagcgagtatccaaatgaatttgatattgttgttggaaaacaaatgctatttaaggttggaat |
244 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||| ||||| || |||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
49825418 |
ggagtgcgttttatttgatcagggtaaaccctcaag----cgagtatcccaatgagttggatatttttgttggaaaacaaatgctatttaaggttgaaat |
49825323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University