View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_293 (Length: 248)
Name: NF6864A_low_293
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_293 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 5 - 236
Target Start/End: Complemental strand, 1329667 - 1329436
Alignment:
| Q |
5 |
ctggttcctctggtggtggaagggccttgacttcattcatatcctcttccggttcaggttcgggttcgggttccttggcttcttcatccgaattgttctc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329667 |
ctggttcctctggtggtggaagggccttgactgcattcatatcctcttccggttcaggttcgggttcgggttccttggcttcttcatccgaattgttctc |
1329568 |
T |
 |
| Q |
105 |
ttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctttggtgtgaccttatctatctca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329567 |
ttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctttggtgtgaccttatctatctca |
1329468 |
T |
 |
| Q |
205 |
gggtactcagaagagcgacaaattccaatatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1329467 |
gggtactcagaagagcgacaaattccaatatt |
1329436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University