View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_297 (Length: 248)
Name: NF6864A_low_297
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_297 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 147 - 235
Target Start/End: Complemental strand, 37616877 - 37616789
Alignment:
| Q |
147 |
atcttttctttttattactctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37616877 |
atcttttctttttattactctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
37616789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 163 - 235
Target Start/End: Original strand, 19768426 - 19768498
Alignment:
| Q |
163 |
actctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19768426 |
actctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
19768498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 147 - 235
Target Start/End: Original strand, 29199924 - 29200010
Alignment:
| Q |
147 |
atcttttctttttattactctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
235 |
Q |
| |
|
|||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29199924 |
atctttcctttttattattctc--taacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
29200010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 147 - 227
Target Start/End: Complemental strand, 51389543 - 51389463
Alignment:
| Q |
147 |
atcttttctttttattactctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccct |
227 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
51389543 |
atcttttctttttatcactctttctaaaacttctttgtttgatctttttatggatttgcatttgcgagaatttaagcccct |
51389463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 147 - 227
Target Start/End: Original strand, 770512 - 770592
Alignment:
| Q |
147 |
atcttttctttttattactctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccct |
227 |
Q |
| |
|
||||||||||||||| || || ||||| ||||||||||||| | ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
770512 |
atcttttctttttatcaccctgtctaaaacttctttgtttggcctttttatggatttgcatttgcgagaatttaagcccct |
770592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 147 - 184
Target Start/End: Original strand, 32663150 - 32663187
Alignment:
| Q |
147 |
atcttttctttttattactctctctaacacttctttgt |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
32663150 |
atctttcctttttattactctctctaacacttatttgt |
32663187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University