View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_300 (Length: 248)
Name: NF6864A_low_300
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_300 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 34092598 - 34092365
Alignment:
| Q |
1 |
ataattaatttaaaaaatcttttattgtaagattgttaaagannnnnnnaaaaccaatattgatgttttaattaaatttgaaagatattttnnnnnnncg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||| ||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
34092598 |
ataattaatttaaaaaatcttttattgtaggcttgttaaagatttttttaaaaccaattttgatgttttaattaaatttgaaagatattttaaaaaaacg |
34092499 |
T |
 |
| Q |
101 |
atgttatgttaaagatgaaataaatattttgattaaccttgtattaaataatttttggtagaaaaaatagaaaacttagtctgtatatgatgggatttgt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34092498 |
atgttatgttaaagattaaataaatattttgattaaccttgtattaaataatttttggtagaaaaaatagaaaacttagtctgtatatgatgtgatttgt |
34092399 |
T |
 |
| Q |
201 |
tttcaaaggagattgtatatgatgtgatgtccat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34092398 |
tttcaaaggagattgtatatgatgtgatgtccat |
34092365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University