View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_307 (Length: 247)
Name: NF6864A_low_307
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_307 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 115 - 226
Target Start/End: Original strand, 5954750 - 5954861
Alignment:
| Q |
115 |
attaaggaataagcatcttaaacaaatcaatacccacaagtttcttaactaaaaaccagactaactaaaaatatattttcaccagtgatcactaaaaatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5954750 |
attaaggaataagcatcttaaacaaatcaatacccacaagtttcttaactaaaaaccagactaactaaaaatatattttcaccagtgatcactaaaaatt |
5954849 |
T |
|
| Q |
215 |
cccatatgatct |
226 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5954850 |
cccatatgatct |
5954861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University