View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_313 (Length: 246)
Name: NF6864A_low_313
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_313 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 53 - 216
Target Start/End: Complemental strand, 9457309 - 9457146
Alignment:
| Q |
53 |
gaaaatcaagattaattgtaatttataaacattttatctctcccctacacaaaacacaaacttgagatcggtaacaaaatgagtgttgagatttttatta |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457309 |
gaaaatcaagattaattgtaatttataaacattttatctctcccctacgcaaaacacaaacttgagatcggtaacaaaatgagtgttgagatttttatta |
9457210 |
T |
 |
| Q |
153 |
ccgtattccaaaatggctatatgtgatttttattacaatctaatgatcatctataaagtaaaca |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457209 |
ccgtattccaaaacggctatatgtgatttttattacaatctaatgatcatctataaagtaaaca |
9457146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 9458370 - 9458329
Alignment:
| Q |
16 |
ataaacaaaatccaaaaggaactgaaagaggaattgcgaaaa |
57 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
9458370 |
ataaacaaaatccaaaaggaattgaaagaggaattgtgaaaa |
9458329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University