View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6864A_low_313 (Length: 246)

Name: NF6864A_low_313
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6864A_low_313
NF6864A_low_313
[»] chr7 (2 HSPs)
chr7 (53-216)||(9457146-9457309)
chr7 (16-57)||(9458329-9458370)


Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 53 - 216
Target Start/End: Complemental strand, 9457309 - 9457146
Alignment:
53 gaaaatcaagattaattgtaatttataaacattttatctctcccctacacaaaacacaaacttgagatcggtaacaaaatgagtgttgagatttttatta 152  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
9457309 gaaaatcaagattaattgtaatttataaacattttatctctcccctacgcaaaacacaaacttgagatcggtaacaaaatgagtgttgagatttttatta 9457210  T
153 ccgtattccaaaatggctatatgtgatttttattacaatctaatgatcatctataaagtaaaca 216  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
9457209 ccgtattccaaaacggctatatgtgatttttattacaatctaatgatcatctataaagtaaaca 9457146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 9458370 - 9458329
Alignment:
16 ataaacaaaatccaaaaggaactgaaagaggaattgcgaaaa 57  Q
    ||||||||||||||||||||| |||||||||||||| |||||    
9458370 ataaacaaaatccaaaaggaattgaaagaggaattgtgaaaa 9458329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University