View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_318 (Length: 245)
Name: NF6864A_low_318
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_318 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1045608 - 1045813
Alignment:
| Q |
1 |
cgatcttttcttcactgtttgaatctattcgattaacaagtataataaataactcattgtaatcacgttttgtgctcctaattttttcaatttatcttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1045608 |
cgatcttttcttcactgtttgaatctattcgattaacaagtataataaataactcattgt-------------gctcctaattttttcaatttatcttgt |
1045694 |
T |
 |
| Q |
101 |
tatttgttatttttggcaaacattctgtgtgtgtgactgaaatttttgttaaaatttaaagaaaatggaaaagtagtttgtttaaggagttgatatgact |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1045695 |
tatctgttatttttggcaaacattctgtg--tgtgactgaaatttttgttaaaatttaaagaaaatggaaaagtagtttgtttaaggagttgatatgact |
1045792 |
T |
 |
| Q |
201 |
tgaattgtggctataacttat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1045793 |
tgaattgtggctataacttat |
1045813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University