View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_322 (Length: 245)
Name: NF6864A_low_322
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_322 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 21 - 245
Target Start/End: Original strand, 3015575 - 3015796
Alignment:
| Q |
21 |
aaaggattcaaggaaatggacttgttatgtcatacttcttgctatcgtcctcgtcatcgtgctcctgtttccattgttgatgtcaattctacctcacttg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3015575 |
aaaggattcaaggaaatggacttgttatgtcatacttcttgctatcgtcctcgtcatcgtgctcctgtttccattgttgatgtcaattctacctcacttg |
3015674 |
T |
 |
| Q |
121 |
tttctgtagaattaaaaggtcaaagtcgtcgtcgtcatcatcatcgttattaaacaaagaatcttagagagtattagattttatgcattctgatatgtca |
220 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3015675 |
tttctgtagaattaaaaggtcaaa---gtcgtcatcatcatcatcgttattaaacaaagaatcttagagagtattagattttatgcattctgaaatgtca |
3015771 |
T |
 |
| Q |
221 |
aggaacatgctgcatgagctagcag |
245 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3015772 |
aggaacatgctgcatgagctagcag |
3015796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University