View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6864A_low_329 (Length: 244)

Name: NF6864A_low_329
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6864A_low_329
NF6864A_low_329
[»] chr7 (1 HSPs)
chr7 (9-244)||(41641628-41641863)


Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 41641628 - 41641863
Alignment:
9 gagatgaatgcaattgagacacttttgataatagatgaactttataggaatgaagagattgagatgaggaaaaaatatgagagcatggtgaaatctgtga 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41641628 gagatgaatgcaattgagacacttttgataatagatgaactttataggaatgaagagattgagatgaggaaaaaatatgagagcatggtgaaatctgtga 41641727  T
109 aacaaggtggaggaaaggctttggtgtattcttctatgcatgtttcgacaccacaattggctcagctaacaggtgttgcggcaattctcagatttccatt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41641728 aacaaggtggaggaaaggctttggtgtattcttctatgcatgtttcgacaccacaattggctcagctaacaggtgttgcggcaattctcagatttccatt 41641827  T
209 acctggtcttcaagatatgaatgatgatgatcatgt 244  Q
    ||||||||||||||||||| ||||||||||||||||    
41641828 acctggtcttcaagatatggatgatgatgatcatgt 41641863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University