View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_337 (Length: 244)
Name: NF6864A_low_337
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_337 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 2281995 - 2281765
Alignment:
| Q |
1 |
atcaagttgatagagaaaaagattggttagttagttaaatttatgcatcatccatgcatctaacctccaaccctccttaaatcattttattaagtttaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
2281995 |
atcaagttgatagagaaaaagattggttagttagttaaatttatgcatcatccatgcatctaacctcgaaccctccttaaatcattttatcaagtttaat |
2281896 |
T |
|
| Q |
101 |
ttagtactattaatactcaattcataactattcaattgatagaaataatttttatnnnnnnnnnngtgagagaaatatcaatgttcttcgataagtggtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2281895 |
ttagtactattaatactcaattcataactattcaattgatagaaataatgtttat-aaaaaaaaagtgagagaaatatcaatgttcttcgataagtggtg |
2281797 |
T |
|
| Q |
201 |
gaggtagtttaatttttagggataaacatatt |
232 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
2281796 |
gaggtagtttaatttttagggttaaacatatt |
2281765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University