View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_341 (Length: 244)
Name: NF6864A_low_341
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_341 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 21 - 236
Target Start/End: Original strand, 37492129 - 37492344
Alignment:
| Q |
21 |
atggtgtatgtgcatactgcatagtggttaagatcattctgtttacatttaattgcaaattagaatgatgctactcttatttttgtaatgatgctttgat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492129 |
atggtgtatgtgcatactgcatagtggttaaaatcattctgtttacatttaatttcaaatcagaatgatgctactcttatttttgtaatgatgctttgat |
37492228 |
T |
 |
| Q |
121 |
ttctttggttggtttacttgaaatggcaaaggataaggagcaaagcagttcagattacagaagctgtgttccgtccaatccgatccattctgatccaatc |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37492229 |
ttctttggttgttttacttgaaatggcaaaggataaggagcaaagcagttcagattacagaagctgtgttccgtccaatccgatccattccgatccaatc |
37492328 |
T |
 |
| Q |
221 |
cattccatttcatttc |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37492329 |
cattccatttcatttc |
37492344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University