View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6864A_low_360 (Length: 241)

Name: NF6864A_low_360
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6864A_low_360
NF6864A_low_360
[»] chr8 (1 HSPs)
chr8 (20-68)||(3116377-3116425)


Alignment Details
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 20 - 68
Target Start/End: Original strand, 3116377 - 3116425
Alignment:
20 agagatgcgtcttttacccctgctttgagattttccatcaaaacaagtg 68  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||    
3116377 agagatgcgtcttttacctctgctttgagattttccatcaaaacaagtg 3116425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University