View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_375 (Length: 239)
Name: NF6864A_low_375
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_375 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 43875589 - 43875360
Alignment:
| Q |
1 |
ggttaggtgagttttcaagccagacagagtaatgatgttttcactcaaattgtctagttgtctttgttatttgttatgtttttctgagtactgttttggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875589 |
ggttaggtgagttttcaagccagacagagtaatgatgttttcccccaaattgactagttgtctttgttatttgttatgtttttctgagtactgttttggt |
43875490 |
T |
|
| Q |
101 |
ttcaaaataagtgttgtattgatgatagtaaatgcattgcattcaaaaaacaaatgaaacagtggaatagcatcagcattagtttctgaatggtgctagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875489 |
ttcaaaataagtgttgtattgatgatagtaaatgcattgcattcaaaaaacaaataaaacagtgaaatagcatcagcattagtttctgaatggtgctagt |
43875390 |
T |
|
| Q |
201 |
cttctaggcaccaggcagcatcattttctt |
230 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
43875389 |
cttctaggcaccaggcagcatcatattctt |
43875360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University