View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_381 (Length: 237)
Name: NF6864A_low_381
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_381 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 237
Target Start/End: Original strand, 30523011 - 30523228
Alignment:
| Q |
20 |
gtatccatgcttcataatctctaacaaatgcccattagacacttaagtataatcactttgttaaagacatggttcatgtataatttcatttcattttgat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30523011 |
gtatccatgcttcataatctctaacaaatgcccattagacacttaagtctaatcactttgttaaagacatggttcatgtataatttcatttcattttgat |
30523110 |
T |
|
| Q |
120 |
aatgcaaattgatttcttagctgctccaatactaaatcaatttagctataaactagcatgtctaatgttaattataatgtgatgatattatatgcttata |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30523111 |
aatgcaaattgatttcttagctgctccaatactaaatcaatttagctataagctagcatgtctaatgttaattataatgtgatgatattatatgcttata |
30523210 |
T |
|
| Q |
220 |
acaacatctaagctttga |
237 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
30523211 |
acaacatctaaactttga |
30523228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University