View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_388 (Length: 236)
Name: NF6864A_low_388
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_388 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 30574101 - 30573884
Alignment:
| Q |
16 |
ggacatcataagaaggaatacaacaatccgataaaaggtcatggttttattgtgtgaagctcacttaccggttccnnnnnnnnnnnnnnnnnnaaaaaac |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30574101 |
ggacatgataagaaggaatacaacaatccgataaaaggtcatggttttattgtgtgaagctcacttaccggttcctttttttttattttt---aaaaaac |
30574005 |
T |
 |
| Q |
116 |
tcagtatgtgacctaaggaccgactaattcgaaaggtcaaatcccacatcgacttacggggacccttttaaagttagagcaaaactctatatggactatc |
215 |
Q |
| |
|
||| ||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30574004 |
tcaatatctgacctaaggaccgactaatccgaaaggtcaaatcccacatcgacttgtggggacccttttaaagttagagcaaaactctatatggactatc |
30573905 |
T |
 |
| Q |
216 |
ccaccgaactgctgtggaaaa |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30573904 |
ccaccgaactgctgtggaaaa |
30573884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University