View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_392 (Length: 236)
Name: NF6864A_low_392
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_392 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 23 - 224
Target Start/End: Complemental strand, 42662245 - 42662044
Alignment:
| Q |
23 |
atatgcaagctcttgttgttgtgcaagcttggagaaaagaattggttttcaattagatgaagctgatcttgaagatctcttgattcctaacattggttac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42662245 |
atatgcaagctcttgttgttgtgcaagcttggagaaaagaattggttttcaattagatgaagctgatcttgaagatctcttgattcctaacattggttac |
42662146 |
T |
|
| Q |
123 |
tcaatggagacaatccatgatattgattgtgttcaaagaatgcttgatcatttcatgattgttgataatgatgatgctgattctacatctaataatgata |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42662145 |
tcaatggagacaatccatgatattgattgtgttcaaagaatgcttgatcatttcatgattgttgataatgatgatgctgattctacatctaataatgata |
42662046 |
T |
|
| Q |
223 |
tt |
224 |
Q |
| |
|
|| |
|
|
| T |
42662045 |
tt |
42662044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University