View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_397 (Length: 234)
Name: NF6864A_low_397
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_397 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 21 - 223
Target Start/End: Complemental strand, 24999484 - 24999282
Alignment:
| Q |
21 |
gaatggaccggaggatttctcgattccggcggcggcttgggaggcgatgaaggttcggtcttcttcagatgttctgccgaggctgaatgttacggaattc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24999484 |
gaatggaccggaggatttctcgattccggcggcggcttgggaggcgatgaaggttcggtcttcttcagatgttctgccgaggctgaatgttacggaattc |
24999385 |
T |
|
| Q |
121 |
gatgaaacgaaggtgagtgatgaaattgatgaagttggagtagttgagtgtgatgatagggttttggttagagattctccggcggagagtagtgtcggtg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24999384 |
gatgaaacgaaggtgagtgatgaaattgatgaagttggagtagttgagtgtgatgatagggttttggttagagattctccggcggagagtagtgtcggtg |
24999285 |
T |
|
| Q |
221 |
ata |
223 |
Q |
| |
|
||| |
|
|
| T |
24999284 |
ata |
24999282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 24894272 - 24894213
Alignment:
| Q |
24 |
tggaccggaggatttctcgattccggcggcggcttgggaggcgatgaaggttcggtcttc |
83 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24894272 |
tggaccggaggatttctccattccggcggcggcttgggaggcgatgaaggctcggtcttc |
24894213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University