View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_399 (Length: 234)
Name: NF6864A_low_399
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_399 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 216
Target Start/End: Complemental strand, 1968950 - 1968757
Alignment:
| Q |
23 |
taacagagaaacaaataatatggaatcataagaatagaatgggaaattctaaggtcaggtgacatattaaaaatcgtaatataggatctcaattaatttg |
122 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1968950 |
taacaaagaaacaaataatatggaatcataagaatagaatgggaaattccaaggtcaggtgacatattaaaaatcgtaatataggatctcaattaatttg |
1968851 |
T |
 |
| Q |
123 |
ataattgttaattcatttatatagataccataatcttttataacagtaggtgaaaactttacatttgnnnnnnnttagttgttggttagtttct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1968850 |
ataattgttaattcatttatatagataccataatcttttataatagtgggtgaaaactttacatttgaaaaaaattagttgttggttagtttct |
1968757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University