View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_400 (Length: 234)
Name: NF6864A_low_400
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_400 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 18 - 174
Target Start/End: Original strand, 14705779 - 14705935
Alignment:
| Q |
18 |
aaagaatccagtgcatctctgcaatccatccacctcattacgttgtactacagtgtcataaactttaaactaaaatttgccatgagataaacactgaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14705779 |
aaagaatccagtgcatctctgcaatccatccacctcattactttgtactacagtgttataaactttaaactaaaatttgccatgagataaacactgaaat |
14705878 |
T |
 |
| Q |
118 |
gctgttgagaaatctagtatatacacgactatatcattattatatataatcacttct |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14705879 |
gctgttgagaaatctagtatatacacgactatatcattattatatataatcacttct |
14705935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University