View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_404 (Length: 232)
Name: NF6864A_low_404
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_404 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 93 - 213
Target Start/End: Complemental strand, 6029388 - 6029268
Alignment:
| Q |
93 |
tcttcttcctccaagatgtcttcagtgtcttcccattcgaacgtaaatcgaaatttctcactaggcttgataacacgcagcttaggttttttcaaacctg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6029388 |
tcttcttcctccaagatgtcttcagtgtcttcccattcgaacgtaaatcgaaatttctcactaggcttgataacacgcatcttaggttttttcaaacctt |
6029289 |
T |
|
| Q |
193 |
gctttttctgatgctcacact |
213 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6029288 |
gctttttctgatgctcacact |
6029268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 99 - 201
Target Start/End: Complemental strand, 6029665 - 6029562
Alignment:
| Q |
99 |
tcctccaagatgtcttc-agtgtcttcccattcgaacgtaaatcgaaatttctcactaggcttgataacacgcagcttaggttttttcaaacctggcttt |
197 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||| || |||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
6029665 |
tcctccaagatgtcttctagtttcttcccattcgaaagtaaatcgaaatttctcactaggtttaataacacgcatcttaggttttttcaaacctagcttt |
6029566 |
T |
|
| Q |
198 |
ttct |
201 |
Q |
| |
|
|||| |
|
|
| T |
6029565 |
ttct |
6029562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 111 - 213
Target Start/End: Complemental strand, 6029505 - 6029403
Alignment:
| Q |
111 |
tcttcagtgtcttcccattcgaacgtaaatcgaaatttctcactaggcttgataacacgcagcttaggttttttcaaacctggctttttctgatgctcac |
210 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| |||||||||||||||| ||||||||||||| ||||||||||||| ||||| || |||||| ||||||| |
|
|
| T |
6029505 |
tcttcagtgttttcccattcgaacataaattgaaatttctcactagggttgataacacgcatcttaggttttttcgaaccttgcgttttctcctgctcac |
6029406 |
T |
|
| Q |
211 |
act |
213 |
Q |
| |
|
||| |
|
|
| T |
6029405 |
act |
6029403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 110 - 213
Target Start/End: Complemental strand, 6034496 - 6034393
Alignment:
| Q |
110 |
gtcttcagtgtcttcccattcgaacgtaaatcgaaatttctcactaggcttgataacacgcagcttaggttttttcaaacctggctttttctgatgctca |
209 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||| ||||| || ||||||||| ||||||||||||| ||||| ||||||||| ||||| | |
|
|
| T |
6034496 |
gtcttcagtgttttcccaatcgaacgtaaatcgaaatttctcgctaggtttagtaacacgcatcttaggttttttcgaacctagctttttcttatgctta |
6034397 |
T |
|
| Q |
210 |
cact |
213 |
Q |
| |
|
|||| |
|
|
| T |
6034396 |
cact |
6034393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 6029416 - 6029366
Alignment:
| Q |
47 |
ctcctgctctcattcccctaggttgttctcttcttcctccaagatgtcttc |
97 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6029416 |
ctcctgctcacactcccctaggttgttctcttcttcctccaagatgtcttc |
6029366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University