View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_411 (Length: 231)
Name: NF6864A_low_411
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_411 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 24 - 213
Target Start/End: Original strand, 34683208 - 34683397
Alignment:
| Q |
24 |
gacatcatgaggattatgagcagaacctctatgaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaat |
123 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34683208 |
gacatcatgaagattatgagcagaacctctataaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaat |
34683307 |
T |
|
| Q |
124 |
caaacaaacttgatattctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacacaaaaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34683308 |
caaacaaacttgatattctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacacaaaaaa |
34683397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 35 - 208
Target Start/End: Original strand, 34699438 - 34699611
Alignment:
| Q |
35 |
gattatgagcagaacctctatgaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaatcaaacaaactt |
134 |
Q |
| |
|
||||||||||| ||| || ||||||||||||| ||||||||| | |||| |||||||| | ||| |||||| || || |||| ||| ||||| |||||| |
|
|
| T |
34699438 |
gattatgagcacaacatcaatgaaagtgggagccaactctgcgagtgtcttaagagagctatcaattacaatcaataatatgacaaagtcaaagaaactt |
34699537 |
T |
|
| Q |
135 |
gatattctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacaca |
208 |
Q |
| |
|
|||| | | |||| ||||||||||| ||| | | |||||| || |||||||||||||| ||| |||||||||| |
|
|
| T |
34699538 |
gatagtttggtcaaagagatgaatattgctacacaagagctacaaaatttattaaaatcatattcaaacacaca |
34699611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University