View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_434 (Length: 230)
Name: NF6864A_low_434
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_434 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 79 - 230
Target Start/End: Complemental strand, 25933416 - 25933262
Alignment:
| Q |
79 |
ttgtatgttaaattaatcatttttcaagaacaaacc---attattgtgttttgatgttaactttctgatttttagagaaagggcgttcaacttagtttaa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25933416 |
ttgtatgttaaattaatcatttttcaagaacaaaccgtaattattgtattttgatgttaactttctgattttcagagaaagggcgttcaacttagtttaa |
25933317 |
T |
 |
| Q |
176 |
taaaaacgacaacaatcaaacattattccatctccttgactatgagacggatatt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933316 |
taaaaacgacaacaatcaaacattattccatctccttgactatgagacggatatt |
25933262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University