View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_456 (Length: 229)
Name: NF6864A_low_456
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_456 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 31869642 - 31869862
Alignment:
| Q |
9 |
agaccagcaagatatttgagtgttaataattctcaaccacaaacatcgacttcaaaaaataannnnnnncgatgttttaaatggcagtgtaaaggttaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31869642 |
agaccagcaagatatttgagtgttaataattctcaaccacaaacatcgacttcaaaaaataatttttttcgatgttttaaatggcagtgtaaaggttaca |
31869741 |
T |
 |
| Q |
109 |
ctacatttgccagcagacctttagattgcatcatgtaatgcagctgcaaaggttttaaacagaagtctgtgactgagatctgggcagcaacatcagggtt |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31869742 |
ctacatttgccagcagacttttagattgcatcatgtaatgcagctgcaaaggttttaaacagaagtttgtgactgagatctgggcagcaacatcagggtt |
31869841 |
T |
 |
| Q |
209 |
tttgttgttactgtgactata |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31869842 |
tttgttgttactgtgactata |
31869862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University