View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_459 (Length: 229)
Name: NF6864A_low_459
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_459 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33499154 - 33499377
Alignment:
| Q |
1 |
tcgatggaggaaacttacaagcaagcagctttagaaattatgacgaggatcgcttaaaattttgatcataaaacttgtcttttcattccgtatgaatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499154 |
tcgatggaggaaacttacaagcaagcagctttagaaattatgacgaggatcgcttaaaattttgatcataaaacttgtcttttcattccgtatgaatttt |
33499253 |
T |
|
| Q |
101 |
attttcc-tcctatcggaaacagttagaattggccatctttgatggtcctatgagacattttatggtgtttaaactagttaaattatttgctttttgtgt |
199 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499254 |
attttccttccgatcggaaacagttagaattggccatctttgatggtcctatgagacattttatggtgtttaaactagttaaattatttgctttttgtgt |
33499353 |
T |
|
| Q |
200 |
ttgcttttccaatattgtaaactg |
223 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
33499354 |
ttgcttttctaatattgtaaactg |
33499377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 137 - 209
Target Start/End: Original strand, 33486210 - 33486284
Alignment:
| Q |
137 |
ctttgatggtcctatgagacatttt-atggtgtttaaactagtta-aattatttgctttttgtgtttgcttttcc |
209 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
33486210 |
ctttgatggtcctaagagcaatttttatggtgtttaaactagttttaattatatgctttttgtgtttgcttttcc |
33486284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 33486144 - 33486212
Alignment:
| Q |
8 |
aggaaacttacaagcaagcagctttagaaattatgacgaggatcgcttaaaattttgatcataaaactt |
76 |
Q |
| |
|
||||||| |||||||| || ||| ||||||||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
33486144 |
aggaaacatacaagcatgcggctggagaaattatgatgtggatcgcttagaattttgatcataaaactt |
33486212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University