View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_461 (Length: 229)
Name: NF6864A_low_461
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_461 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33662441 - 33662664
Alignment:
| Q |
1 |
aatatgtatagtcgaggtttaaactcggacactccactaatttatctataagagatgaatttctaacgataaaatgctaaaatgtttgaagttaaagttt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33662441 |
aatatgtatagtcgaggtttgaactcggacactccactaatttatctataagagatgaatttctaacgataaaatgctaaaatgtttgaagttaaagttt |
33662540 |
T |
|
| Q |
101 |
aaacaactcattaattaaaaaatgataaacaactatctc-nnnnnnnnggggcacattaaacaactatatctaccttaatttgaataatgaaagcaacaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33662541 |
aaacaactcattaattaaaaaatgataaacaactatctctttttttttggggtacattaaacaactatatctaccttaatttgaataatgaaagcaacaa |
33662640 |
T |
|
| Q |
200 |
ttctgcggatatgatagtcctaag |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33662641 |
ttctgcggatatgatagtcctaag |
33662664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 203
Target Start/End: Original strand, 33672083 - 33672130
Alignment:
| Q |
156 |
ttaaacaactatatctaccttaatttgaataatgaaagcaacaattct |
203 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
33672083 |
ttaaacaactatatctaccttaaatggaataatgaaagaaacaattct |
33672130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University