View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_465 (Length: 229)
Name: NF6864A_low_465
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_465 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36930498 - 36930715
Alignment:
| Q |
1 |
agtgggatagctacgatatcatttaggaaaacagctgtgtagtgtagtgtgggacaaccataaacaaaatacatataaaaatcgaataacatattatttc |
100 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36930498 |
agtgggatagctacgataccattaaggaaaacagctgtgt-----agtgtgggacaaccataaactaaatacatataaaaatcgaataacatattatttc |
36930592 |
T |
|
| Q |
101 |
acatcaaaataatttcataagaatgggatagctgctatgcctggaccttcaatgcgtgcatggctgaatcacggaaaacaacattaacaaggtacaacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36930593 |
acatcaaaataatttcataagaatgggatagctgctatgcctggaccttcaatgcgtgcatggctgaatgacggaaaacaacattaacaaggtacaacaa |
36930692 |
T |
|
| Q |
201 |
tagctgtgtggtgtggagcaacc |
223 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
36930693 |
tagctgtgtggtgtggggcaacc |
36930715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University