View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_467 (Length: 229)
Name: NF6864A_low_467
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_467 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 34092829 - 34093057
Alignment:
| Q |
1 |
gattaggacttttctcaatgagaaactttgccaaagtcagattgatattgaataattggctaaacaaatctcacattatatatacacaaccacttgaaat |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34092829 |
gattaggacttttctcaataagaaactttgccaaagtcagattgatattgaataattggcaaaacaaatctcacattatatatacacaaccacttgaaat |
34092928 |
T |
 |
| Q |
101 |
aaaagaaacaattacattgtatgcaaatcattatcgttggctattagagcatatattaattcaaagatgaaaaagacattggtagctagaaaaatgaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34092929 |
aaaagaaacaattacattgtatgcaaatcattatcgttggctattagagcatatattaattcaaagatgaaaaagacattggtagctagaaaaatgaaga |
34093028 |
T |
 |
| Q |
201 |
agaggcattaggttaggtatatgtgatga |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
34093029 |
agaggcattaggttaggtaaatgtgatga |
34093057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University