View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_470 (Length: 229)
Name: NF6864A_low_470
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_470 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 205
Target Start/End: Original strand, 38929915 - 38930113
Alignment:
| Q |
7 |
ttataaacattattcattataaggtataatggtaataattattttaataatgttccccccattatacagtgttgattaagatcccttaaaaaagattaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38929915 |
ttataaacattattcattataaggtataatggtaataattattttaataatgttccccccattagacagtgttgattaagatcccttaaaaaagattaca |
38930014 |
T |
|
| Q |
107 |
tgaatttgtagatagtttaataaaattcatgctaaaagtaattttgacagaaacatccaatttcatctctcaatatttatatcactaaacgtctatgtt |
205 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38930015 |
taaatttgtagatagtttaataaaattcatgctaaaagtaattttgacagaaacatccaatttcatctctcaatatttatatcactaaacgtctatgtt |
38930113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University