View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_476 (Length: 228)
Name: NF6864A_low_476
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_476 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 55 - 201
Target Start/End: Original strand, 45922788 - 45922934
Alignment:
| Q |
55 |
ccaaacatacaatatgcatgatgtatgatttgccgcgtctggtctagaggatgaaacgaagtgaaaacttacattgcagaacaaaatggatgctcagcca |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45922788 |
ccaaacatacaatatgcatgatgtatgatttgccgcttctggtctagaggatgaaacgaaatgaaaacttacattgcagaacaaagtggatgctcagcca |
45922887 |
T |
 |
| Q |
155 |
tttcgaactcttcactaagcaaggaggaggaatgcaggttattgttt |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
45922888 |
tttcgaactcttcgctaagcaaggaggaggaatgcaagttattgttt |
45922934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University