View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_479 (Length: 228)
Name: NF6864A_low_479
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_479 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 68 - 208
Target Start/End: Complemental strand, 14073993 - 14073853
Alignment:
| Q |
68 |
gagaagctgaaagagatgggtgtggacgaggttatagtgacgggtgtgatgactaacttgtgctgtgagacaacggcgcgcgaggcctttattagaggct |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14073993 |
gagaagctgaaagagatgggtgtggacgaggttatagtgacgggtgtgatgactaacttgtgctgtgagacaacggcgcgcgaggcctttattagaggct |
14073894 |
T |
|
| Q |
168 |
tcagggggtttttctccactgatgcaactgctacctctgat |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14073893 |
tcagggtgtttttctccactgatgcaactgctacctctgat |
14073853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 68 - 208
Target Start/End: Complemental strand, 14081469 - 14081329
Alignment:
| Q |
68 |
gagaagctgaaagagatgggtgtggacgaggttatagtgacgggtgtgatgactaacttgtgctgtgagacaacggcgcgcgaggcctttattagaggct |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14081469 |
gagaagctgaaagagatgggtgtggacgaggttatagtgacgggtgtgatgactaacttgtgctgtgaaacaacggcgcgcgaggcctttattagaggct |
14081370 |
T |
|
| Q |
168 |
tcagggggtttttctccactgatgcaactgctacctctgat |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14081369 |
tcagggtgtttttctccactgatgcaactgctacctctgat |
14081329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 115 - 208
Target Start/End: Complemental strand, 14104893 - 14104800
Alignment:
| Q |
115 |
gatgactaacttgtgctgtgagacaacggcgcgcgaggcctttattagaggcttcagggggtttttctccactgatgcaactgctacctctgat |
208 |
Q |
| |
|
|||||||||| | || |||||||||||||||| ||| ||||||||||||||||||||| ||| |||||| ||||||||| ||||||||||||| |
|
|
| T |
14104893 |
gatgactaacctatgttgtgagacaacggcgcatgagacctttattagaggcttcagggtgttcttctccgctgatgcaagtgctacctctgat |
14104800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University