View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_480 (Length: 228)
Name: NF6864A_low_480
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_480 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 49375606 - 49375829
Alignment:
| Q |
1 |
tgaaagagccctaaaatttctttctcatcccataccaagcaacgtgtgttttgctcatctcacactgcattttctaaagtttaagcaacacagagtgcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||| |
|
|
| T |
49375606 |
tgaaagagccctaaaatttctttctcatcccataccaagcaacgtgtgttttgctcatctcacactgcattttctaaactttaaacaatacagagtgcac |
49375705 |
T |
 |
| Q |
101 |
gttcaaggcaaaaccacacaacttctcttttaccttaattaaagttttaacatgtcatttaacttc--nnnnnnncccaaattagtcatttatcttnnnn |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49375706 |
gttcaaggcaaaaccacacaacttctcttttaccttaattaaagttttaacatgtcatttaacttcttcttttttcccaaattagtcatttatctt-aaa |
49375804 |
T |
 |
| Q |
199 |
nnntatttaactgcttattcaactt |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49375805 |
aaatatttaactgcttattcaactt |
49375829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University