View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_485 (Length: 227)
Name: NF6864A_low_485
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_485 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 212
Target Start/End: Complemental strand, 3675535 - 3675343
Alignment:
| Q |
20 |
atatgatgggtttttgtcaaaatttaatttgtatggaactttaattaataannnnnnnaatcttaggtatttgcttgtggtagcattttttacaagtata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675535 |
atatgatgggtttttgtcaaaatttaatttgtatggaactttaattaataatttttttaatcttaggtatttgcttgtggtagcattttttacaagtata |
3675436 |
T |
 |
| Q |
120 |
tacacaggaagccaagtgtatcgtcaaattcatgaacttatcactgggaataatatatttcgacctacaactgcagctgtgattgatattgtt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3675435 |
tacacaggaagccaagtgtatcgtcaaattcatgaacttatcactgggaataatatatttcgacctacaactgcagctgtgattgattttgtt |
3675343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University