View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_488 (Length: 227)
Name: NF6864A_low_488
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_488 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 43703077 - 43703303
Alignment:
| Q |
1 |
tcaacagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703077 |
tcaacagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtttaa |
43703176 |
T |
 |
| Q |
101 |
acttggttttattcacattacttttatcaccaacatgagttggtccgacttgaaggggctcggatcccttgagcaagaggtataggattcaaaatttagt |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703177 |
actttgttttattcacattacttttatcgccaacatgagttggtccgacttgaaggggctcggatcccttgagcaagaggtataggattcaaaatttagt |
43703276 |
T |
 |
| Q |
201 |
ttttgtgaatcaagcaaattctgttgg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43703277 |
ttttgtgaatcaagcaaattctgttgg |
43703303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University