View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_495 (Length: 225)
Name: NF6864A_low_495
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_495 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 207
Target Start/End: Complemental strand, 35603848 - 35603664
Alignment:
| Q |
22 |
tatctctactgtagaatatcatgtcatttttaatggatgttcacaatgggccaattactcctgaaagagttctccgacaaagatgtcccctctcgccata |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603848 |
tatctctactgtagaatatcatgtcatttttaatg-atgttcacaatggaccaattactcctgaaagagttctccgacaaagatgtcccctctcgccata |
35603750 |
T |
 |
| Q |
122 |
ctcatatattatatgtaccgaaggtttgccggccatcatagaaaataacgagattttgggtaagctttatgagactagtatctatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
35603749 |
ctcatatattatatgtaccgaaggtttgccggccatcataaaaaataacgagatttagggtaagctttatgagactcgtatctatg |
35603664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University